Gielisella nigripalpis
| Notice: | This page is derived from the original publication listed below, whose author(s) should always be credited. Further contributors may edit and improve the content of this page and, consequently, need to be credited as well (see page history). Any assessment of factual correctness requires a careful review of the original article as well as of subsequent contributions.
If you are uncertain whether your planned contribution is correct or not, we suggest that you use the associated discussion page instead of editing the page directly. This page should be cited as follows (rationale):
Citation formats to copy and paste
BibTeX: @article{Koster2017NotaLepidopterologica40, RIS/ Endnote: TY - JOUR Wikipedia/ Citizendium: <ref name="Koster2017Nota Lepidopterologica40">{{Citation See also the citation download page at the journal. |
Ordo: Lepidoptera
Familia: Elachistidae
Genus: Gielisella
Name
Gielisella nigripalpis Koster & Nieukerken, 2017 sp. n. – Wikispecies link – ZooBank link – Pensoft Profile
Type material
Holotype ♂, Spain, Almería, Enix, 36°52’38.49”N 2°36’24.83”W, 7.iii.2015, coll. nr. 587; gen. slide JCK 8362, RMNH.INS.544307 (RMNH). Paratype 1♂, same locality as holotype, 30.i.2013, coll. nr. 431 (PGC) [abdomen lost during dissection].
Diagnosis
Gielisella nigripalpis differs from G. clarkeorum by the blackish brown tipped palpi, and the absence of the dark brown longitudinal streaks on the forewings. In the male genitalia it differs by the proportionally placed setae on the uncus; by apically narrowing anellus lobes without lateral projection; the spoon-shaped valvae and by the two very long cornuti at the distal end of the row cornuti.
Description
Male (Figs 2, 12). Forewing length 5.2–5.9 mm. Head: frons shining pale grey with greenish and reddish reflections and with greyish brown irroration laterally, vertex and neck tufts shining white, in middle strongly irrorate dark brownish grey, collar shining white, irrorate greyish brown; labial palpus first segment short, white, second segment white, strongly irrorate greyish brown dorsally and laterally on outside, apex white, third segment white with broad, brown basal and blackish brown apical ring, extreme tip white; scape dorsally and ventrally shining brownish grey, pecten with 8–9 hairs; flagellum shining pale ochreous-grey. Thorax shining white, strongly irrorate dark brownish grey in middle and laterally in anterior half. Tegulae shining dark brownish grey, laterally and ventrally lined white. Legs: dorsally shining dark greyish brown, ventrally white with some greyish irroration; tarsomeres one and two of foreleg with white apical rings; tibia midleg with white basal and medial streaks and white apical ring, tarsomeres one to four with whitish apical rings; tibia hindleg dorsally pale ochreous-grey, tarsomeres as midleg; spurs midleg and inner spur hindleg whitish, outer spurs hindleg dark brown. Forewing ground colour shining whitish with more or less irrorate by greyish ochreous and greyish brown scales and ochreous streaks; two blackish brown dots with raised scales and three blackish brown streaks, first spot below fold at one-fourth, second spot, larger than first, above fold at two-third, first streak narrow, above dorsum near base, second streak just above middle at one third, third streak at apex; several small dark brown spots in costal cilia; two small dark brown fringe lines; cilia pale ochreous-grey and with dark brown streak at apex. Hindwing shining greyish white with some greenish and reddish gloss; pale ochreous-grey. Underside: forewing shining brownish grey, ochreous-grey in distal half; hindwing shining greyish white. Abdomen not examined.
Male genitalia (Figs 8, 9, 14, 15, 19, 20). Uncus as two broad, short and rounded lobes with 16 setae proportional placed across the width. Gnathos arms (Fig. 16) long and slender, upwards bent at one-third of base, upper side transversely covered with pecten of 36 flat peglike setae, about one and half width of gnathos arm. Tegumen large, longer than wide, slightly narrowing distally. Valvae long, strongly narrowing after one-third, distally slightly widening till spoon-shaped apex, edges and apex weakly spined. Anellus lobes large, strongly sclerotized, ventral edge with short spines, strongly tapering distally, apex with three curved teeth, laterally with small triangular tooth. Vinculum broad with heart-shaped saccus and shield-shaped juxta. Phallus (Figs 9, 19, 20) long, curved less than 90 degrees, slightly tapering distally, apex pointed, vesica with narrow row of approximately 13 slender cornuti in distal half of last two cornuti are as long and longer than previous row.
Measurements: Length from vinculum to uncus 590 μm, valva length 525 μm, phallus length (measured in straight line) 655 μm; longest cornutus 125 μm.
Distribution
(Fig. 29). Spain, province Almería.
Biology
Host-plants and early stages are unknown. The specimens were collected at light in the same locality as G. clarkeorum, suggesting a similar life history (Figs 26–27). They were found in January and March.
DNA barcodes
We barcoded the holotype, with BIN BOLD:ACY4816, at a distance of 7.2% to G. clarkeorum (Table 1).
The barcode reads:
aactttatattttatttttggaatttgagcaggaatagtaggtacatctcttagtttattaattcgagctgaactaggaacccccggatctttaattggtgatgatcaaatttataatactattgttacagctcacgcttttattataattttttttatagttatacctattataattggaggatttggaaattgattagttcctttaatattaggagccccagatatagctttcccccgaataaataatataagtttttgattattacctccttctcttacccttttaatttcaagtagtattgtagaaaatggagctgggacaggatgaacggtttacccccccctttcatctaatatcgctcatagaggtagatcagtagatttagcaattttttcccttcatttagctggaatttcttcaattttaggagctattaattttattacaactattattaatatacgattaataaatatatcttttgatcaaatacccctatttgtttgagcagttgggatcacagctcttcttcttcttctttccttacctgttttagctggagctattactatattattaacagatcgtaatttaaatacctcattttttgatcctgctggtggaggagaccctattttataccaacatttattt
Etymology
The epitheton nigripalpis is the dative plural of the noun nigripalpus, meaning “with black palpi”, referring to the black palpal tip.
Original Description
- Koster, J; Nieukerken, E; 2017: Gielisella gen. n., a new genus and two new species from southern Spain (Lepidoptera: Elachistidae: Parametriotinae) with a catalogue of parametriotine genera Nota Lepidopterologica, 40(2): 163-202. doi
Images
|
