Amynthas daeari
| Notice: | This page is derived from the original publication listed below, whose author(s) should always be credited. Further contributors may edit and improve the content of this page and, consequently, need to be credited as well (see page history). Any assessment of factual correctness requires a careful review of the original article as well as of subsequent contributions.
If you are uncertain whether your planned contribution is correct or not, we suggest that you use the associated discussion page instead of editing the page directly. This page should be cited as follows (rationale):
Citation formats to copy and paste
BibTeX: @article{Blakemore2013ZooKeys307, RIS/ Endnote: TY - JOUR Wikipedia/ Citizendium: <ref name="Blakemore2013ZooKeys307">{{Citation See also the citation download page at the journal. |
Ordo: Haplotaxida
Familia: Megascolecidae
Genus: Amynthas
Name
Amynthas daeari Blakemore & Lee & Lee & Seo, 2013 sp. n. – Wikispecies link – ZooBank link – Pensoft Profile
Material examined
IV0000261261, mature specimen complete but broken in two at clitellum after being figured and dissected. Collected from small valley at Jeollabuk-do, Wanju-gun, Dongsang-myeon, Daea-ri (35.9801N, 127.2981E); collected 27th July, 2012 by Dr Hong-Yul Seo. DNA tissue sample code – w53.
Etymology
Noun from location.
Diagnosis
Amynthas with two pairs of spermathecal pores in 6/7/8 complying with an Amynthas tokioensis-group; spermathecae with compressed clavate diverticula; GMs median to spermathecal and male pores with patches around the former and the latter bracketed laterally by small C-shaped clefts.
Distribution
Only known from a single specimen from type locality.
Habitat
In litter layer in forest.
Behaviour. Habitat, pigmentation and gut contents indicate activity in the litter layer.
Description
Length. 150 mm.
Width. ca. 7 mm at male pore level.
Segments. 107.
Colour. Brown in alcohol, possibly darker in life as liquid was stained.
Prostomium. Open epilobous.
First dorsal pore. 12/13.
Setae. Ca. 60 per segment, approximately 22-24 between spermathecal and male pores.
Nephropores. Not found.
Clitellum. Annular 14-16, setae occluded.
Male pores. On 18 centred on small, round porophore (found by following a pin from prostate gland exit) with GMs anterio-median and shallow clefts laterally (that function as seminal ducts and/or suction cups?).
Female pores. Single on 14.
Spermathecal pores. 6/7/8 ca 0.3 C apart at edge of puckered area and lateral to GMs.
Genital markings. Paired discs just median to male and spermathecal pores as noted; composite glands on spermathecal pore GMs but none found for GMs near male pores although the body here is macerated and they may well have broken off and dissipated.
Septa. Nephridial forests on septa 5 & 6; 7/8 thin, 8/9/10 aborted.
Dorsal blood vessel (dbv). Single.
Hearts. Last hearts in 13 (preceding vascularization unclear/damaged).
Gizzard. Single in 8-9.
Calciferous glands. Absent.
Intestine. Indeterminate as specimen macerated; caeca ventrally incised from 27; typhlosole not noted.
Nephridia. Meroic.
Male organs. Holandric, seminal vesicles in 11 & 12.
Ovaries. In 13 as usual.
Prostates. Racemose glands in 17-19, duct short and muscular.
Spermathecae. Two pairs in 7 and 8; that in 7lhs inflated, that in 8lhs deflated (showing how meaningless such a distinction is although relied on by some authors).
Gut contents. Coarse organic debris, i.e., a litter diet suggesting superficial feeding.
DNA COI barcode
>w53 Amynthas daeari Holotype.
CTATATTTCATTTTAGGAATTTGAGCTGGAATAATTGGGGCAGGAATAAGACTGCTTATTCGAATTGAGCTAAGACAGCCGGGCTCTTTTCTAGGAAGGGATCAACTCTATAATACAATTGTAACAGCTCATGCATTTTTAATAATCTTCTTTCTTGTAATACCAGTATTTATTGGTGGGTTTGGAAATTGACTTCTACCTCTAATACTAGGTGCCCCAGATATAGCTTTCCCGCGACTTAACAATATAAGATTCTGATTACTGCCCCCATCACTAATTTTACTAGTATCGTCTGCAGCAGTAGAAAAAGGTGCCGGAACAGGATGGACAGTGTACCCCCCACTTGCGAGAAACATTGCACATGCCGGCCCTTCAGTAGATCTTGCAATTTTTTCTCTCCATCTAGCCGGAGCATCATCAATTCTCGGTGCCATCAACTTCATTACTACCGTAATTAATATACGATGATCTGGGCTACGCTTAGAACGAATTCCTCTATTTGTATGAGCAGTTGTAATTACTGTAATTCTTTTACTTCTATCTTTACCAGTCTTAGCCGGTGCTATTACAATATTACTAACAGACCGAAACCTAAATACATCATTTTTTGATCCAGCGGGAGGAGGTGATCCAATTCTATATCAACACTTATTT
megaBLAST result: “ Amynthas tappensis” (AB542547.1) from Japan max. identity <88% this then is a different and likely new taxon. The closest match from current Korean studies with BLASTn identity 565/653 (87%) is WO49, an immature Amynthas sp. from Jeju that itself comes closest to the Amynthas tokioensis/Metaphire hilgendorfi spp. complexes (see Blakemore 2013a[1]: Appendix).
Remarks
Of Amynthas species with spermathecae in 6/7/8, twenty or so in the Amynthas tokioensis-group of Sims and Easton (1972)[2] mostly have manicate caeca, such as Amynthas kanrazanus (Kobayashi, 1937); about twenty other species, many placed in this group after 1972, have simple intestinal caeca. Only four have simple incised caeca as here, but they all differ in characteristics of their GMs, at least, and none of these latter are known from Korea (Blakemore unpublished). The incised caeca is assumed to be a characteristic transitional or intermediate from simple to complex/manicate. The GMs in 7-8 obviously correspond to those in 18 during amphimixis but it is not known whether they interlock serially. The shape of the spermathecae and spermathecal pores are further distinguishing characteristics of Amynthas daeari that, along with its objective DNA barcode data, now serve to define this taxon.
Original Description
- Blakemore, R; Lee, S; Lee, W; Seo, H; 2013: Two new Korean earthworms (Annelida, Oligochaeta, Megadrilacea, Megascolecidae) ZooKeys, 307: 35-44. doi
Other References
- ↑ Blakemore R (2013a) Jeju-do earthworms (Oligochaeta: Megadrilacea) - Quelpart Island revisited. Journal of Species Research 2(1): 15–54. www.nibr.go.kr/eng/event/journal_spe_3.jsp, doi: 10.12651/JSR.2013.2.1.015
- ↑ Sims R, Easton E (1972) A numerical revision of the earthworm genus Pheretima auct. (Megascolecidae: Oligochaeta) with the recognition of new genera and an appendix on the earthworms collected by the Royal Society North Borneo Expedition. Biological Journal of the Linnean Society 4: 169-268. doi: 10.1111/j.1095-8312.1972.tb00694.x
Images
|
![Figure 1. Amynthas daeari sp. n. showing ventral view with spermathecae, their composite genital marking glands and 18lhs prostate in situ plus incised intestinal caecum in 27; dorsal view of prostomium; [boxed are lateral views of spermathecal pores and male field in 18rhs to same scale].](/wiki/File:ZooKeys-307-035-g001.jpg)
