Amauropelma matakecil

From Species-ID
Jump to: navigation, search

Contents

Notice: This page is derived from the original publication listed below, whose author(s) should always be credited. Further contributors may edit and improve the content of this page and, consequently, need to be credited as well (see page history). Any assessment of factual correctness requires a careful review of the original article as well as of subsequent contributions.

If you are uncertain whether your planned contribution is correct or not, we suggest that you use the associated discussion page instead of editing the page directly.

This page should be cited as follows (rationale):
Miller J, Rahmadi C (2012) A troglomorphic spider from Java (Araneae, Ctenidae, Amauropelma). ZooKeys 163 : 1–11, doi: 10.3897/zookeys.163.2265. Versioned wiki page: 2012-01-09, version 20401, http://species-id.net/w/index.php?title=Amauropelma_matakecil&oldid=20401 , contributors (alphabetical order): Pensoft Publishers.

Citation formats to copy and paste

BibTeX:

@article{Miller2012ZooKeys163,
author = {Miller, Jeremy AND Rahmadi, Cahyo},
journal = {ZooKeys},
publisher = {Pensoft Publishers},
title = {A troglomorphic spider from Java (Araneae, Ctenidae, Amauropelma)},
year = {2012},
volume = {163},
issue = {},
pages = {1--11},
doi = {10.3897/zookeys.163.2265},
url = {http://www.pensoft.net/journals/zookeys/article/2265/abstract},
note = {Versioned wiki page: 2012-01-09, version 20401, http://species-id.net/w/index.php?title=Amauropelma_matakecil&oldid=20401 , contributors (alphabetical order): Pensoft Publishers.}

}

RIS/ Endnote:

TY - JOUR
T1 - A troglomorphic spider from Java (Araneae, Ctenidae, Amauropelma)
A1 - Miller J
A1 - Rahmadi C
Y1 - 2012
JF - ZooKeys
JA -
VL - 163
IS -
UR - http://dx.doi.org/10.3897/zookeys.163.2265
SP - 1
EP - 11
PB - Pensoft Publishers
M1 - Versioned wiki page: 2012-01-09, version 20401, http://species-id.net/w/index.php?title=Amauropelma_matakecil&oldid=20401 , contributors (alphabetical order): Pensoft Publishers.

M3 - doi:10.3897/zookeys.163.2265

Wikipedia/ Citizendium:

<ref name="Miller2012ZooKeys163">{{Citation
| author = Miller J, Rahmadi C
| title = A troglomorphic spider from Java (Araneae, Ctenidae, Amauropelma)
| journal = ZooKeys
| year = 2012
| volume = 163
| issue =
| pages = 1--11
| pmid =
| publisher = Pensoft Publishers
| doi = 10.3897/zookeys.163.2265
| url = http://www.pensoft.net/journals/zookeys/article/2265/abstract
| pmc =
| accessdate = 2013-05-19

}} Versioned wiki page: 2012-01-09, version 20401, http://species-id.net/w/index.php?title=Amauropelma_matakecil&oldid=20401 , contributors (alphabetical order): Pensoft Publishers.</ref>

See also the citation download page at the journal.


Taxonavigation

Ordo: Araneae
Familia: Ctenidae
Genus: Amauropelma

Name

Amauropelma matakecil Miller & Rahmadi sp. n.Wikispecies linkZooBank linkPensoft Profile

Material examined

Holotype: Indonesia, Central Java, Purworejo, Kaligesing, Tlogoguo Village, Somoroto: Gua Anjani [Anjani Cave], 7.73156°S, 110.11567°E, 672 m asl., 23 March 2009 (MZB.Aran.500, S. Harjanto), 1 #f.
Paratypes: Indonesia, Central Java, Purworejo, Kaligesing, Donorejo Village, Katerban: Gua Seplawan [Seplawan Cave], 7.7726°S, 110.111°E, 23 April 2010 (MZB.Aran.501, S. Harjanto and C. Rahmadi), 1 #f; Indonesia, Central Java, Purworejo, Kaligesing, Donorejo Village, Katerban: Gua Nguwik [Nguwik Cave], 7.76907°S, 110.10334°E, 764 m asl., 9 May 2008 (RMNH.ARA.12434, S. Harjanto), 1 #f.
Additional material examined: Indonesia, Central Java, Purworejo, Kaligesing, Tlogoguo Village, Somoroto: Gua Anjani [Anjani Cave], 7.73156°S, 110.11567°E, 672 m asl., 23 April 2010 (RMNH.ARA.12436, S. Harjanto and C. Rahmadi), 2 juveniles; Gua Anjani [Anjani Cave], 7.73156°S, 110.11567°E, 672 m asl., 23 March 2009 (MZB.Aran.502, S. Harjanto), 1 juvenile.

Etymology

The specific name is an adjective derived from "mata" meaning eyes and "kecil" meaning small from Bahasa Indonesia referring to the small eyes of the species. Pronunciation note: the letter “c” in Bahasa is pronounced like “ch” in English.

Diagnosis

. Distinguished from other Amauropelma species by having more cheliceral teeth (4 promargin and 7 retromargin teeth, Fig. 4; other described species for which data were recorded range between 1–4 promargin and 4–6 retromargin teeth); by the relatively proximal position of the tarsal organs (Fig. 10); by the sclerotized epigynal teeth that do not conduct the copulatory ducts (Fig. 7; other Amauropelma have soft teeth containing the copulatory ducts); and by the shape of the epigynum, which has the lateral wings more long and narrow than other species (Fig. 7). Further distinguished from other Amauropelma species except Amauropelma leo Raven & Sumkat, 2001 by having small eyes (Fig. 2; large in other species except Amauropelma undara, which is a blind troglobite); distinguished from Amauropelma leo by the pale, troglomorphic color (Figs 1, 3); Amauropelma leo is a rainforest species and is not troglomorphic.

Description

Female (holotype, MZB.Aran.500): Carapace 3.40 long, 2.20 wide. Abdomen 4.12, long 2.64 wide. Total length 7.7. Carapace with fine setae. Fovea a narrow groove. Chilum divided (Fig. 2). Endites slightly converging, labium longer than wide (Fig. 4). Color. Overall pale, chelicerae and ocular region darker (Figs 1, 3). Eyes. Vestigial, eye rows recurved forming 2.4.2 pattern, ALE>AME=PME>PLE, AME on small common tubercle, ALE and PME form slightly procurved row, PME closer together than PME-ALE, PME slightly more widely spaced than AME, eye group = 0.40 of carapace width (Figs 2, 3). Chelicerae. Large, partially porrect with lateral boss. Retromargin with 5 large distal and 2 small proximal teeth; promargin with 4 teeth, the third (counting proximally from the base of the fang) is the smallest (Fig. 4). Pedipalp. Tarsal claw with series of basal teeth. With two large ventral distal setae (ca. Silva Dávila 2003[1]: fig. 28d). Legs. Formula 4123. Paired tarsal claws with series of basal teeth, claw tufts present, weak scopula present on tarsi and metatarsi I and II (Fig. 9). Retrocoxal hymen present on leg I. Trochanters deeply notched (Fig. 5). Tarsal organs slightly raised, dome-like, more distal on legs I and II than III and IV (I: 0.77. II: 0.73. III: 0.66. IV: 0.67). Macrosetae: I: fe p1d3; pa 0; ti v2.2.2.2.2; me v3.3.3; ta 0. II: fe d3r1; pa 0; ti v2.2.2.2.2; me v3.3.3; ta 0. III: fe p4d3r4; pa p1r1; ti v2.2.2p1.1d1.1 r1.1; me v2.2.2p1.1.2r1.1.2; ta 0. IV: fe p3d3r1; pa r1; ti v2.2.2p1.1d1.1r1.1; me v1.1.1.1.2p1.1.1d0.1.2r1.1.1. Spinnerets. Ecribellate, colulus absent, lateral spinnerets cylindrical with short apical segment, ALS separated by about their width, PLS and PMS with a number of large, conspicuous spigots (Figs 11, 12). Epigynum. Sclerotized plate with long, narrow lateral wings with concave posterior margins. Epigynal teeth sclerotized, arise posterior to lateral wings (Fig. 7). Copulatory openings on dorsal surface near lateral margins of wings, follow posterior margin of wings to reniform spermathecae (Fig. 8).

Natural History

In Seplawan Cave, Amauropelma matakecil was found on the cave floor hiding under crevices in dry mud.

Distribution

Amauropelma matakecil is known only from three caves in the Jonggrangan Limestone, part of the Menoreh Hills in the District of Kaligesing, Purworejo Regency, Central Java, near the border with Yogyakarta Province (Fig. 13). The Jonggrangan Limestone is located from 574–878 m above sea level (Bemellen 1949[2]). This karst formation is a fossil reef with thicknesses up to 200 m at the southern margin of the Jonggrangan Plateu (Bemellen 1949[2]). The formation dates from the Middle to Late Miocene (Sulistyaningrum and Rahardjo 2010[3]). Karst makes up a very small area of the Menoreh hills, about 15 km2. The nearest neighboring limestone formations are the Gombong Selatan (about 72 km to the west) and the Gunung Sewu Karst (about 42 km to the east).

Remarks

The cave spider fauna of Java is not well known. The only other spider documented from a cave in Java that we are aware of is Althephus javanensis Deeleman-Reinhold, 1995 (Ochyroceratidae). This species is not strongly troglomorphic, exhibiting neither eye reduction nor reduced pigmentation, although legs in specimens from caves are considerably longer than in specimens from the surface. As reported by Rahmadi (2011)[4], Amauropelma matakecil is the most remarkable cave spider so far known from Java due to its large size, reduced eyes, and potential conservation importance. Karst formations in Java are highly threatened by human activities such as limestone mining and habitat conversion.

DNA Barcode

AACGTTATATTTAATATTTGGAGCTTGATCTGC TATAATAGGAACGGCTATAAGAATATTAATTCGAATAGAGTTAGGA CATTCTGGAAGATTATTAAGTAATGATCATTTGTATAATGTGATTGT TACTGCTCATGCATTTGTTATAATTTTTTTTATGGTGATGCCAATTT TAATTGGAGGTTTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCTC CGGATATATCGTTTCCTCGAATAAATAATTTGTCTTTTTGATTGTTAC CTCCTTCTTTGTTTTTGTTGTTTATATCTTCTATAGTTGAAATGG GAGTAGGAGCTGGATGAACTATTTATCCCCCTTTAGCTTCTAGAATTG GTCATGTGGGAAGATCTATGGATTTTGCTATTTTTTCTTTACATT TAGCTGGAGCTTCTTCTATTATAGGGGCGGTAAATTTTATTTCTAC GATTGTAAATATACGTTTATTAGGAATAAGAATAGAAAGGGTTCCTT TATTTGTGTGATCTGTATTTATTACTGCTGTTTTATTATTATTATCTT TACCTGTTTTAGCGGGAGCTATTACTATGTTATTGACGGATCGAAATTT TAATACTTCTTTTTTTGACCCTGCAGGGGGAGGGGATCCTATTT TATTTCAACATTTGTTT (MZB.Aran.501, GenBank accession number JQ277219).
Among identified spiders accessible at the time of writing (October 2011) through the NCBI database (http://blast.ncbi.nlm.nih.gov/Blast.cgi), Amauropelma matakecil blasts most closely with the pisaurid genus Dolomedes Latreille, 1804. This despite the presence in GenBank of the homologous locus for several ctenid spiders (e.g., Crews and Gillespie 2010[5]). However, its closest matches are several still unidentified spiders in the International Barcode of Life (iBOL) database.

Original Description

Other References

  1. Silva Dávila D (2003) Higher-level relationships of the spider family Ctenidae (Araneae: Ctenoidea). Bulletin of the American Museum of Natural History 274: 1-86. doi: <0001:HLROTS>2.0.CO;2 10.1206/0003-0090(2003)274<0001:HLROTS>2.0.CO;2
  2. 2.0 2.1 Bemellen v (1949) The Geology of Indonesia, volume 1A. Martinus Nijhoff, The Hague, 602 pp.
  3. Sulistyaningrum D, Rahardjo W (2010) Identification and paleoecology of coraline fossils (Cnidaria: Anthozoa) from Jonggrangan limestone, western slope of Kucir Hill,West Progo area, Yogyakarta Special Province. Proceedings, Indonesian Petroleum Association Thirty-Fourth Annual Convention & Exhibition, May 2010, 9 pp.
  4. Rahmadi C (2011) The biospeleology of Java Caves, Indonesia: A Review. Proceeding of Asian Trans-Disciplinary Karst Conference 2011, Yogyakarta-Indonesia: 241–250.
  5. Crews S, Gillespie R (2010) Molecular systematics of Selenops spiders (Araneae: Selenopidae) from North and Central America: implications for Caribbean biogeography. Biological Journal of the Linnean Society 101: 288-322. doi: 10.1111/j.1095-8312.2010.01494.x

Images

Figures 1–6. Amauropelma matakecil sp. n. 1 female habitus 2–6 habitus of female holotype (MZB.Aran.500) 1 Portrait of live specimen in natural habitat from Gua Nguwik, Central Java (Photo S. Harjanto) 2 Anterior view 3 Dorsal view 4 Ventral view showing labium, endites, and chelicerae 5 Ventral view showing sternum, coxae, and trochanters 6 Left pedipalpal, retrolateral view.
Figures 1–6. Amauropelma matakecil sp. n. 1 female habitus 2–6 habitus of female holotype (MZB.Aran.500) 1 Portrait of live specimen in natural habitat from Gua Nguwik, Central Java (Photo S. Harjanto) 2 Anterior view 3 Dorsal view 4 Ventral view showing labium, endites, and chelicerae 5 Ventral view showing sternum, coxae, and trochanters 6 Left pedipalpal, retrolateral view. 
Figures 7–12. Amauropelma matakecil sp. n., female holotype (MZB.Aran.500) 7 Epigynum, ventral view. Note that the right epigynal tooth has broken off leaving a round hole; the tooth itself is lying unattached near the epigastric furrow 8 Vulva, dorsal view, left side, cleared, white arrow indicates fertilization duct 9 Right tarsus, leg I, prolateral view 10 Left tarsus, leg I, dorsal view, arrow indicates tarsal organ 11 Spinnerets, anal tubercle, and tracheal spiracle, posterior view, arrow indicates tracheal spiracle 12 Spinnerets, lateral view. ALS, anterior lateral spinneret; AT, anal tubercle; CD, copulatory duct; ET, epigynal tooth; PLS, posterior lateral spinneret; PMS, posterior median spinneret; S, spermatheca.
Figures 7–12. Amauropelma matakecil sp. n., female holotype (MZB.Aran.500) 7 Epigynum, ventral view. Note that the right epigynal tooth has broken off leaving a round hole; the tooth itself is lying unattached near the epigastric furrow 8 Vulva, dorsal view, left side, cleared, white arrow indicates fertilization duct 9 Right tarsus, leg I, prolateral view 10 Left tarsus, leg I, dorsal view, arrow indicates tarsal organ 11 Spinnerets, anal tubercle, and tracheal spiracle, posterior view, arrow indicates tracheal spiracle 12 Spinnerets, lateral view. ALS, anterior lateral spinneret; AT, anal tubercle; CD, copulatory duct; ET, epigynal tooth; PLS, posterior lateral spinneret; PMS, posterior median spinneret; S, spermatheca. 
Figure 13. Map of Java, Indonesia, showing records of Amauropelma matakecil sp. n. as yellow circles in Central Java. Base map source: Google Earth.
Figure 13. Map of Java, Indonesia, showing records of Amauropelma matakecil sp. n. as yellow circles in Central Java. Base map source: Google Earth. 
Personal tools
Namespaces

Variants
Actions
Navigation
Toolbox
Sister projects
Print/export